circad | circRNAs associated with diseases

hsa_circ_0053743
Gene	BIRC6	Organism	Human
Genome Locus	chr2:32702435-32718734:+	Build	hg19
Disease	Facet joint Osteoarthritis	ICD-10	Polyarthrosis, unspecified (M15.9)
DBLink	Link to database	PMID	29470979
Experimental Method
Sample Type	Facet joint Tissues	Comparison	10 vertebral fracture patients as control with 48 Facet joint Osteoarthritis (FjOA) patients with lumbar surgery
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAATTTTTGCTCAAGCTAATTCA Reverse CATTCTGCTGTCCGACGTAA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Chu, C, Chunshuai, W, Jiajia, C, Jinlong, Z, Pengfei, X, Jiawei, J, Zhiming, C (2018). Transcriptional information revealed differentially expressed circular RNAs in facet joint osteoarthritis. Biochem. Biophys. Res. Commun., 497, 2:790-796.